peak-motifs CEBPa_ChIP-seq_in_dog_liver_CRM_vs

Motif discovery

Motif 1 oligos_6nt_test_vs_ctrl_m1

CrCCCTrsCCTGrCCyGGGkCACr

YGTGMCCCRGGYCAGGSYAGGGYG

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CrCCCTrsCCTGrCCyGGGkCACr

Total maches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1283 (5.39%)
Max nb of predicted sites per peak: 16
(canFam2_chrX_34538787_34539039_+)
Mean nb of predicted sites per peak: 1.72

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_test_vs_ctrl_m2

ATCCAAAGTCCAGAGCAGGGAAT

ATTCCCTGCTCTGGACTTTGGAT

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ATCCAAAGTCCAGAGCAGGGAAT

HNF4A MA0114.2 R 13 0.5200 0.774 0.402 ATCCAAAGTCCAG.......... ..GKYCAAAGKYCAG

Total maches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1018 (4.28%)
Max nb of predicted sites per peak: 4
(canFam2_chrX_34538787_34539039_+)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_test_vs_ctrl_m3

mdGGGTCAGrg

CYCTGACCCHK

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mdGGGTCAGrg

ESR2 MA0258.1 D 11 0.6111 0.848 0.518 mdGGGTCAGrr cwrGGTCAsgk.......

RORA_1 MA0071.1 D 8 0.6154 0.834 0.513 mdGGGTCA... ..cwAGGTCA

NR2C2 MA0504.1 D 11 0.7333 0.775 0.568 mdGGGTCAGrr mgrGGTCArAG....

Total maches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1424 (5.98%)
Max nb of predicted sites per peak: 4
(canFam2_chrX_117667_118058_+)
Mean nb of predicted sites per peak: 1.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_test_vs_ctrl_m4

GGCAGGGCAGCCGGGTCAGCCCTG

CAGGGCTGACCCGGCTGCCCTGCC

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGCAGGGCAGCCGGGTCAGCCCTG

Total maches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1701 (7.14%)
Max nb of predicted sites per peak: 37
(canFam2_chr12_61548699_61549034_+)
Mean nb of predicted sites per peak: 2.38

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_test_vs_ctrl_m5

cmAAGGTCAGrr

YYCTGACCTTKG

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor cmAAGGTCAGrr

Esrrb MA0141.2 D 9 0.6000 0.957 0.574 cmAAGGTCA... ...yCAAGGTCA

RORA_1 MA0071.1 D 9 0.6923 0.913 0.632 cmAAGGTCA... .wcwAGGTCA

Esrrb MA0141.1 D 9 0.6000 0.956 0.574 cmAAGGTCA... ...yCAAGGTCA

Total maches= 16 (13 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 701 (2.94%)
Max nb of predicted sites per peak: 3
(canFam2_chr31_15121815_15122329_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_7nt_test_vs_ctrl_m1

TykGGCCAGyCCAAAGTCCArGAy

RTCYTGGACTTTGGRCTGGCCMRA

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TykGGCCAGyCCAAAGTCCArGAy

HNF4A MA0114.2 R 15 0.6250 0.832 0.520 ......CAGyCCAAAGTCCAr... RRGKYCAAAGKYCAG

HNF4G MA0484.1 D 15 0.6250 0.775 0.484 .....CCAGyCCAAAGTCCA.... arrGkyCAAAGkyCA

HNF4A MA0114.1 D 13 0.5417 0.801 0.434 .......AGyCCAAAGTCCA.... rGgbCAAAGkyCa

Total maches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 527 (2.21%)
Max nb of predicted sites per peak: 2
(canFam2_chr3_56856516_56856841_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_7nt_test_vs_ctrl_m2

CACCTGCCCTTTGACCTGGCCACG

CGTGGCCAGGTCAAAGGGCAGGTG

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CACCTGCCCTTTGACCTGGCCACG

NR2C2 MA0504.1 R 15 0.6250 0.787 0.492 ....TGCCCTTTGACCTGG..... TGACCTYTGACCYCK

HNF4A MA0114.1 R 13 0.5417 0.822 0.445 ....TGCCCTTTGACCT....... TGRMCTTTGVCCY

PPARG::RXRA MA0065.2 R 15 0.6250 0.779 0.487 ....TGCCCTTTGACCTGG..... TGMCCTYTGCCCYAS

Total maches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1439 (6.04%)
Max nb of predicted sites per peak: 21
(canFam2_chrX_34538787_34539039_+)
Mean nb of predicted sites per peak: 1.48

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_test_vs_ctrl_m3

hdSGCMCmGGRCAKSSYCAKGCCb

VGGCMTGRSSMTGYCCKGKGCSHD

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hdSGCMCmGGRCAKSSYCAKGCCb

Total maches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1236 (5.19%)
Max nb of predicted sites per peak: 21
(canFam2_chr11_65759712_65760051_+)
Mean nb of predicted sites per peak: 1.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_test_vs_ctrl_m4

TmGGkCCAGkCCAAAGwCCAArwk

MWYTTGGWCTTTGGMCTGGMCCKA

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TmGGkCCAGkCCAAAGwCCAArwk

HNF4A MA0114.1 D 13 0.5417 0.838 0.454 .......AGkCCAAAGwCCA.... rGgbCAAAGkyCa

HNF4A MA0114.2 R 15 0.6250 0.800 0.500 ......CAGkCCAAAGwCCAA... RRGKYCAAAGKYCAG

HNF4G MA0484.1 D 15 0.6250 0.776 0.485 .....CCAGkCCAAAGwCCA.... arrGkyCAAAGkyCA

Total maches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 607 (2.55%)
Max nb of predicted sites per peak: 2
(canFam2_chrX_12960322_12960621_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_test_vs_ctrl_m5

SdCCCAGCCAGRMCAKGGCwGGvk

MBCCWGCCMTGKYCTGGCTGGGHS

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor SdCCCAGCCAGRMCAKGGCwGGvk

Total maches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 790 (3.32%)
Max nb of predicted sites per peak: 7
(canFam2_chr9_12488606_12489112_+)
Mean nb of predicted sites per peak: 1.28

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_8nt_test_vs_ctrl_m1

ysAAGTCCAAAGTCCAGGGrm

KYCCCTGGACTTTGGACTTSR

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ysAAGTCCAAAGTCCAGGGrm

HNF4G MA0484.1 D 15 0.7143 0.841 0.600 .mAAGTCCAAAGTCCA..... arrGkyCAAAGkyCA

HNF4A MA0114.2 R 15 0.7143 0.843 0.602 ..AAGTCCAAAGTCCAG.... RRGKYCAAAGKYCAG

HNF4A MA0114.1 D 13 0.6190 0.799 0.495 ...AGTCCAAAGTCCA..... rGgbCAAAGkyCa

Total maches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 566 (2.38%)
Max nb of predicted sites per peak: 2
(canFam2_chr9_10114300_10114603_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_8nt_test_vs_ctrl_m2

mYTCCArrGmCCAAAGGkCAGvh

DBCTGMCCTTTGGKCYYTGGARK

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mYTCCArrGmCCAAAGGkCAGvh

Rxra MA0512.1 D 11 0.4783 0.905 0.433 ...........CAAAGGkCAGv. CArAGKTCAgd

HNF4G MA0484.1 D 15 0.6522 0.818 0.534 .....ArrGmCCAAAGGkCA... arrGkyCAAAGkyCA

HNF4A MA0114.1 D 13 0.5652 0.862 0.487 .......rGmCCAAAGGkCA... rGgbCAAAGkyCa

Total maches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 596 (2.50%)
Max nb of predicted sites per peak: 2
(canFam2_chr38_16453347_16453674_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_8nt_test_vs_ctrl_m3

ksCCAGAGTCCAGGGat

ATCCCTGGACTCTGGSM

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ksCCAGAGTCCAGGGat

HNF4A MA0114.2 R 13 0.6842 0.784 0.537 ksCCAGAGTCCAG.... ..GKYCAAAGKYCAG

HNF4G MA0484.1 D 12 0.6000 0.774 0.464 ksCCAGAGTCCA..... ...GkyCAAAGkyCA

Total maches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1139 (4.78%)
Max nb of predicted sites per peak: 3
(canFam2_chr6_58183705_58183892_+)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_8nt_test_vs_ctrl_m4

myCCCTGGACTTTGCCCTsb

VSAGGGCAAAGTCCAGGGRK

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor myCCCTGGACTTTGCCCTsb

HNF4A MA0114.2 D 15 0.7500 0.856 0.642 ....CTGGACTTTGCCCTv. cTGrmCTTTGrmCyy

HNF4G MA0484.1 R 15 0.7500 0.853 0.640 .....TGGACTTTGCCCTvb TGRMCTTTGRMCYYT

HNF4A MA0114.1 R 13 0.6500 0.846 0.550 .....TGGACTTTGCCCT.. TGRMCTTTGVCCY

Total maches= 4 (1 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 752 (3.16%)
Max nb of predicted sites per peak: 2
(canFam2_chrX_4294782_4295195_+)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_8nt_test_vs_ctrl_m5

aaAAATCAATAww

WWTATTGATTTTT

[ matrix: tab format transfac format ]

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaAAATCAATAww

Hoxa9 MA0594.1 D 8 0.5000 0.826 0.413 aaAAATCA..... ...ATmAATCA

Foxa2 MA0047.1 R 11 0.7857 0.787 0.618 ..AAATCAATAww RARYMAAYAWT.

Hoxc9 MA0485.1 D 9 0.5294 0.770 0.407 aaAAATCAA.... ....ATAAATCwy

Total maches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1682 (7.07%)
Max nb of predicted sites per peak: 9
(canFam2_chr10_58563941_58564521_+)
Mean nb of predicted sites per peak: 1.21

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus jaspar_core_vertebrates database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSA-tools - peak-motifs result

Analysis: CEBPa_ChIP-seq_in_dog_liver_CRM_vs_Singleton (06/09/2014 12:59)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CrCCCTrsCCTGrCCyGGGkCACr

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ATCCAAAGTCCAGAGCAGGGAAT

HNF4A MA0114.2 R 13 0.5200 0.774 0.402 ATCCAAAGTCCAG.......... ..GKYCAAAGKYCAG

Total maches= 1

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGCAGGGCAGCCGGGTCAGCCCTG

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hdSGCMCmGGRCAKSSYCAKGCCb

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor SdCCCAGCCAGRMCAKGGCwGGvk

Total maches= 0

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

RSA-tools - peak-motifs result

Analysis: CEBPa_ChIP-seq_in_dog_liver_CRM_vs_Singleton (06/09/2014 12:59)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

jaspar_core_vertebrates name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CrCCCTrsCCTGrCCyGGGkCACr Total maches= 0

jaspar_core_vertebrates name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ATCCAAAGTCCAGAGCAGGGAAT HNF4A MA0114.2 R 13 0.5200 0.774 0.402 ATCCAAAGTCCAG.......... ..GKYCAAAGKYCAG Total maches= 1

jaspar_core_vertebrates name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GGCAGGGCAGCCGGGTCAGCCCTG Total maches= 0

jaspar_core_vertebrates name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor hdSGCMCmGGRCAKSSYCAKGCCb Total maches= 0

jaspar_core_vertebrates name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor SdCCCAGCCAGRMCAKGGCwGGvk Total maches= 0

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CrCCCTrsCCTGrCCyGGGkCACr

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ATCCAAAGTCCAGAGCAGGGAAT

HNF4A MA0114.2 R 13 0.5200 0.774 0.402 ATCCAAAGTCCAG.......... ..GKYCAAAGKYCAG

Total maches= 1

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGCAGGGCAGCCGGGTCAGCCCTG

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hdSGCMCmGGRCAKSSYCAKGCCb

Total maches= 0

jaspar_core_vertebrates

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor SdCCCAGCCAGRMCAKGGCwGGvk

Total maches= 0